ID: 1068334503

View in Genome Browser
Species Human (GRCh38)
Location 10:55614835-55614857
Sequence CCTACGAAGTAAACCTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 2, 2: 0, 3: 3, 4: 42}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068334503 Original CRISPR CCTACGAAGTAAACCTTGGT TGG (reversed) Intronic
904974779 1:34447670-34447692 CCTTGGAAGAAAACCTTGGAGGG + Intergenic
907593359 1:55697054-55697076 ACCAGGAAGTGAACCTTGGTTGG + Intergenic
908739310 1:67310399-67310421 CCTACGAAGTCAAAATTGTTTGG + Intronic
910150055 1:84131981-84132003 CCTACAGAGTAGACCTTTGTTGG - Intronic
910173950 1:84408048-84408070 CCTCAGATGTAATCCTTGGTTGG + Intronic
911290371 1:96050252-96050274 CCAAAGAAGTAAACTTTGATTGG - Intergenic
923160809 1:231312979-231313001 CCCACAAATTAAACCTTAGTGGG - Intergenic
1068334503 10:55614835-55614857 CCTACGAAGTAAACCTTGGTTGG - Intronic
1107481765 13:40790922-40790944 CCTAAGAATTAAACCCTGTTAGG - Intronic
1110464273 13:75782958-75782980 ATTAGGAAGTAGACCTTGGTGGG + Intronic
1116053140 14:39829159-39829181 ACTATAAAGTAAACCTTGTTTGG + Intergenic
1122832679 14:104408353-104408375 CCTGCAAAGTCATCCTTGGTGGG - Intergenic
1126409324 15:48355853-48355875 CCTACGAAGTAAAATGTGGCAGG - Intergenic
1126515541 15:49531959-49531981 CTTATGAAGAAATCCTTGGTGGG + Intronic
1127641761 15:60922600-60922622 CATACTAAGTATACCTTGTTTGG - Intronic
1130307327 15:82722172-82722194 CCTAAGAAGGAAACTTTGGCCGG + Intergenic
1134673257 16:16071564-16071586 CCTTGAAAGTTAACCTTGGTTGG + Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1142882274 17:2890980-2891002 CATAAAAAGTAAACATTGGTCGG - Intronic
1145190289 17:20835774-20835796 CCTACCAAGTAAACCTTGGTTGG - Intergenic
1145219821 17:21079094-21079116 CTTACGATTTAAAACTTGGTGGG - Intergenic
1145401502 17:22539652-22539674 CCTACCAAGTAAACCTTGGTTGG - Intergenic
1146615550 17:34354600-34354622 CCTAGGAAGCCAATCTTGGTGGG - Intergenic
927290568 2:21401016-21401038 CCTACTAAGAAAACCTTAGTTGG + Intergenic
944219227 2:197285700-197285722 CCTGCAAAATAAACCTTGGTTGG + Intronic
1172730271 20:37081335-37081357 TCTATAAAGTAAACCTTGGCTGG + Intronic
952113741 3:30154999-30155021 CCTACAAATAAAACCTTGGTAGG + Intergenic
966731800 3:183157904-183157926 CCTATGTAGGAAGCCTTGGTGGG + Intronic
967246932 3:187497348-187497370 CCTCTGAAATAAACCTTGCTTGG - Intergenic
967692991 3:192498487-192498509 CCTAGGAATTAAACCCTGATTGG + Intronic
972714104 4:41628743-41628765 CCTATGAAGTGAACCTTAGCTGG - Intronic
979760988 4:124404786-124404808 CCTATGAATGTAACCTTGGTTGG + Intergenic
985736089 5:1584151-1584173 CTTACAATGTAAAACTTGGTGGG - Intergenic
1007998660 6:46335651-46335673 TCTACAAAGACAACCTTGGTAGG + Intronic
1027475637 7:78627967-78627989 CCCATGCAGTAACCCTTGGTTGG - Intronic
1029256320 7:99272101-99272123 CCTAGGAAGGGAACCTTGTTTGG - Intergenic
1031689256 7:124766558-124766580 GGTACGAAGTAACCCATGGTAGG - Intergenic
1038809002 8:30820840-30820862 CCTACTCAGTAAATCTTGCTGGG - Intergenic
1040528877 8:48249204-48249226 CCTACAATTTAAAACTTGGTGGG - Intergenic
1041008475 8:53518622-53518644 TCTAAGAGGTAACCCTTGGTGGG + Intergenic
1054704994 9:68453005-68453027 CCTATGAAGAAAATATTGGTTGG + Intronic
1187091595 X:16102565-16102587 CCTCAAAGGTAAACCTTGGTTGG + Intergenic
1189623332 X:42867728-42867750 CCTAGGAAGTTAACTTTGCTAGG + Intergenic
1194851438 X:98874754-98874776 CCTACAAAGGAAACCTTATTAGG - Intergenic
1195712806 X:107788110-107788132 CCTAAAAAGTAGAGCTTGGTTGG - Intronic
1200266590 X:154649465-154649487 CCTAGGATGTAAACCCTGCTTGG - Intergenic
1200970753 Y:9150077-9150099 CCTACAATTTAAAACTTGGTGGG - Intergenic
1202140272 Y:21714236-21714258 CCTACAATTTAAAACTTGGTGGG + Intergenic