ID: 1068337438

View in Genome Browser
Species Human (GRCh38)
Location 10:55653614-55653636
Sequence ATAACATTTCAATTTAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068337438_1068337442 12 Left 1068337438 10:55653614-55653636 CCTCCTTTAAATTGAAATGTTAT No data
Right 1068337442 10:55653649-55653671 ACAAGCCTTTTTTGAGTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068337438 Original CRISPR ATAACATTTCAATTTAAAGG AGG (reversed) Intergenic
No off target data available for this crispr