ID: 1068338347

View in Genome Browser
Species Human (GRCh38)
Location 10:55667540-55667562
Sequence GCATCGGAGGGCCCGCTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 1, 2: 7, 3: 8, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068338347_1068338358 12 Left 1068338347 10:55667540-55667562 CCCTTGAGCGGGCCCTCCGATGC 0: 1
1: 1
2: 7
3: 8
4: 37
Right 1068338358 10:55667575-55667597 CTTCTCGATGCCATCATATTTGG 0: 1
1: 0
2: 12
3: 31
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068338347 Original CRISPR GCATCGGAGGGCCCGCTCAA GGG (reversed) Intergenic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
904707483 1:32402303-32402325 GCATCGGAGGCCACCCTCAAGGG - Intergenic
907089017 1:51707332-51707354 GCACCAGAGGGCCCCCTAAAGGG - Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
911044809 1:93619629-93619651 GCATGGGAGGGACCTCTGAAGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1071509128 10:86250338-86250360 GAAACGGAGGGGCTGCTCAAAGG - Intronic
1077533441 11:3107905-3107927 GCAGCGCAGGGCCAGCTCCAGGG + Exonic
1086581794 11:88408371-88408393 GCATCAGAAGGCCCCTTCAAGGG - Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1101252919 12:102952902-102952924 GCCTTGGAGGGCCTGCTCAGGGG - Intronic
1103955488 12:124574168-124574190 GCACAGGAGGGCCCCATCAAGGG + Intergenic
1105547122 13:21359103-21359125 GTATCGGAGGGCCCCCTCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108340710 13:49496137-49496159 GCAGCGACGGGCCCGGTCAAGGG + Intronic
1114443181 14:22767255-22767277 GCGTCGCAGGGCCCTCGCAATGG + Exonic
1115444127 14:33469946-33469968 GCATCAGGGGGCCAGCTCAAGGG + Intronic
1127528373 15:59816767-59816789 GCATCTGAGGGACTGCTCCAGGG + Intergenic
1144862533 17:18314683-18314705 GCCTCGGAGGGCCATCTCCATGG + Exonic
1161276472 19:3421122-3421144 GCATCCGAGGCCCCGCTCCCTGG + Intronic
1164879018 19:31715186-31715208 GCATCGGTGGAACCCCTCAAAGG - Intergenic
1166965425 19:46526974-46526996 GCCTGCGATGGCCCGCTCAAAGG + Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
948560036 2:238846600-238846622 GCATGCGAGGGCCCGCTCCTAGG + Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1175585788 20:60138690-60138712 GGATCGGAGCGGCCGCTCAAAGG + Intergenic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1184515575 22:44959988-44960010 ACAGCGGAGGGCCCGCTCTCTGG - Intronic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
968749354 4:2379189-2379211 GCATTGGGGGGACCGCTCCAGGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
977146392 4:93446253-93446275 GCATTGGAGGGCTGGCACAATGG - Intronic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
988840765 5:35081486-35081508 GCATCGGAGGGCCCCTTCATAGG + Intronic
1001984575 5:176061961-176061983 GCCTCGGAGGGCACCCTCAGAGG + Exonic
1002263052 5:178007583-178007605 GCCTCGGAGGGCACCCTCAGAGG + Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1018658691 6:166065082-166065104 GCATCAGAGGGCTCCCTCTAGGG + Intergenic
1020551778 7:9615770-9615792 GCATCAGAGGGCTCCCTCAAGGG + Intergenic
1028242053 7:88433591-88433613 GCATCTGAGGCCCCGTTCCATGG - Intergenic
1035764951 8:2098451-2098473 GCAGGGCAGGGCCCGCTCAGGGG + Intronic
1053480972 9:38415918-38415940 CCATCTGAGGGCCCTCTGAAGGG + Intronic
1058372997 9:104291948-104291970 GCATCGGAGGTACCGGTCCATGG - Intergenic
1061424218 9:130489077-130489099 GCGTCTGAGGGCCCCTTCAAAGG + Intronic
1186425644 X:9463346-9463368 GCAACGAAGGGCAGGCTCAAGGG + Intronic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1191846709 X:65552233-65552255 GCTTCGGTGGGACCGCTCAGTGG + Intergenic
1199978490 X:152908054-152908076 GCATCTGTGGGCCTGCTCACTGG - Intergenic