ID: 1068357866

View in Genome Browser
Species Human (GRCh38)
Location 10:55934404-55934426
Sequence ACCATGGCTTCAATTCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068357866_1068357870 16 Left 1068357866 10:55934404-55934426 CCATTTAGAATTGAAGCCATGGT No data
Right 1068357870 10:55934443-55934465 ATGATAAAAACAATTGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068357866 Original CRISPR ACCATGGCTTCAATTCTAAA TGG (reversed) Intergenic
No off target data available for this crispr