ID: 1068359755

View in Genome Browser
Species Human (GRCh38)
Location 10:55962031-55962053
Sequence GAGTGGACAGAATTTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068359755_1068359758 -7 Left 1068359755 10:55962031-55962053 CCCAGCTGAAATTCTGTCCACTC No data
Right 1068359758 10:55962047-55962069 TCCACTCTTTAAGGTCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068359755 Original CRISPR GAGTGGACAGAATTTCAGCT GGG (reversed) Intergenic
No off target data available for this crispr