ID: 1068368073

View in Genome Browser
Species Human (GRCh38)
Location 10:56077538-56077560
Sequence GGTGCTTGTACTCATCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068368070_1068368073 -6 Left 1068368070 10:56077521-56077543 CCACTCCCAGTAGGGCTGGTGCT No data
Right 1068368073 10:56077538-56077560 GGTGCTTGTACTCATCATTGAGG No data
1068368066_1068368073 25 Left 1068368066 10:56077490-56077512 CCTTGACGCAATGCACACTGAGC No data
Right 1068368073 10:56077538-56077560 GGTGCTTGTACTCATCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068368073 Original CRISPR GGTGCTTGTACTCATCATTG AGG Intergenic
No off target data available for this crispr