ID: 1068373990

View in Genome Browser
Species Human (GRCh38)
Location 10:56155153-56155175
Sequence TCCAGCTGGCCAGCAAGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068373990_1068373996 -6 Left 1068373990 10:56155153-56155175 CCGGCGCTTGCTGGCCAGCTGGA No data
Right 1068373996 10:56155170-56155192 GCTGGAGTTCCGGGTGGGCGTGG 0: 451
1: 393
2: 420
3: 442
4: 606
1068373990_1068374001 16 Left 1068373990 10:56155153-56155175 CCGGCGCTTGCTGGCCAGCTGGA No data
Right 1068374001 10:56155192-56155214 GCCTTGGCGGGCCCCGCACTCGG No data
1068373990_1068373997 0 Left 1068373990 10:56155153-56155175 CCGGCGCTTGCTGGCCAGCTGGA No data
Right 1068373997 10:56155176-56155198 GTTCCGGGTGGGCGTGGCCTTGG No data
1068373990_1068373999 3 Left 1068373990 10:56155153-56155175 CCGGCGCTTGCTGGCCAGCTGGA No data
Right 1068373999 10:56155179-56155201 CCGGGTGGGCGTGGCCTTGGCGG No data
1068373990_1068374003 25 Left 1068373990 10:56155153-56155175 CCGGCGCTTGCTGGCCAGCTGGA No data
Right 1068374003 10:56155201-56155223 GGCCCCGCACTCGGAGCAGCCGG 0: 194
1: 331
2: 395
3: 311
4: 388
1068373990_1068374007 29 Left 1068373990 10:56155153-56155175 CCGGCGCTTGCTGGCCAGCTGGA No data
Right 1068374007 10:56155205-56155227 CCGCACTCGGAGCAGCCGGCCGG 0: 137
1: 281
2: 325
3: 316
4: 369
1068373990_1068374000 4 Left 1068373990 10:56155153-56155175 CCGGCGCTTGCTGGCCAGCTGGA No data
Right 1068374000 10:56155180-56155202 CGGGTGGGCGTGGCCTTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068373990 Original CRISPR TCCAGCTGGCCAGCAAGCGC CGG (reversed) Intergenic
No off target data available for this crispr