ID: 1068377004

View in Genome Browser
Species Human (GRCh38)
Location 10:56193829-56193851
Sequence TCAGTGTTTTCTAGGCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068377001_1068377004 -6 Left 1068377001 10:56193812-56193834 CCTGTCTGAATTCCAAGTCAGTG No data
Right 1068377004 10:56193829-56193851 TCAGTGTTTTCTAGGCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068377004 Original CRISPR TCAGTGTTTTCTAGGCCTGC AGG Intergenic
No off target data available for this crispr