ID: 1068377139

View in Genome Browser
Species Human (GRCh38)
Location 10:56195519-56195541
Sequence CATTGAAGCGTGAGTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068377139_1068377143 5 Left 1068377139 10:56195519-56195541 CCCACTCTACTCACGCTTCAATG No data
Right 1068377143 10:56195547-56195569 ATGAGCCTAATTTTTCCTGGTGG No data
1068377139_1068377146 21 Left 1068377139 10:56195519-56195541 CCCACTCTACTCACGCTTCAATG No data
Right 1068377146 10:56195563-56195585 CTGGTGGCATGAGAAGTACCTGG No data
1068377139_1068377141 2 Left 1068377139 10:56195519-56195541 CCCACTCTACTCACGCTTCAATG No data
Right 1068377141 10:56195544-56195566 TCCATGAGCCTAATTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068377139 Original CRISPR CATTGAAGCGTGAGTAGAGT GGG (reversed) Intergenic
No off target data available for this crispr