ID: 1068382546

View in Genome Browser
Species Human (GRCh38)
Location 10:56275638-56275660
Sequence TCCAGGTAAAATGAGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068382546_1068382551 13 Left 1068382546 10:56275638-56275660 CCTTGCATCTCATTTTACCTGGA No data
Right 1068382551 10:56275674-56275696 GGATGTTAGATATATAAATGAGG No data
1068382546_1068382548 -9 Left 1068382546 10:56275638-56275660 CCTTGCATCTCATTTTACCTGGA No data
Right 1068382548 10:56275652-56275674 TTACCTGGAGGTAGTTCTGATGG No data
1068382546_1068382549 -8 Left 1068382546 10:56275638-56275660 CCTTGCATCTCATTTTACCTGGA No data
Right 1068382549 10:56275653-56275675 TACCTGGAGGTAGTTCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068382546 Original CRISPR TCCAGGTAAAATGAGATGCA AGG (reversed) Intergenic