ID: 1068382548

View in Genome Browser
Species Human (GRCh38)
Location 10:56275652-56275674
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068382546_1068382548 -9 Left 1068382546 10:56275638-56275660 CCTTGCATCTCATTTTACCTGGA No data
Right 1068382548 10:56275652-56275674 TTACCTGGAGGTAGTTCTGATGG No data
1068382544_1068382548 -4 Left 1068382544 10:56275633-56275655 CCTTTCCTTGCATCTCATTTTAC No data
Right 1068382548 10:56275652-56275674 TTACCTGGAGGTAGTTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068382548 Original CRISPR TTACCTGGAGGTAGTTCTGA TGG Intergenic
No off target data available for this crispr