ID: 1068388617

View in Genome Browser
Species Human (GRCh38)
Location 10:56362554-56362576
Sequence CTATAAATACTGCTGAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068388617_1068388618 1 Left 1068388617 10:56362554-56362576 CCAAACTTCAGCAGTATTTATAG No data
Right 1068388618 10:56362578-56362600 AATAGAAAAATGTTCACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068388617 Original CRISPR CTATAAATACTGCTGAAGTT TGG (reversed) Intergenic
No off target data available for this crispr