ID: 1068391940

View in Genome Browser
Species Human (GRCh38)
Location 10:56409081-56409103
Sequence CTGAGGATAAGTAGCTCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068391940_1068391943 13 Left 1068391940 10:56409081-56409103 CCATTTGAGCTACTTATCCTCAG No data
Right 1068391943 10:56409117-56409139 TTGGACAAGATTAGAGAGAAAGG No data
1068391940_1068391945 15 Left 1068391940 10:56409081-56409103 CCATTTGAGCTACTTATCCTCAG No data
Right 1068391945 10:56409119-56409141 GGACAAGATTAGAGAGAAAGGGG No data
1068391940_1068391944 14 Left 1068391940 10:56409081-56409103 CCATTTGAGCTACTTATCCTCAG No data
Right 1068391944 10:56409118-56409140 TGGACAAGATTAGAGAGAAAGGG No data
1068391940_1068391942 -6 Left 1068391940 10:56409081-56409103 CCATTTGAGCTACTTATCCTCAG No data
Right 1068391942 10:56409098-56409120 CCTCAGATAAGTAAGATAGTTGG No data
1068391940_1068391946 25 Left 1068391940 10:56409081-56409103 CCATTTGAGCTACTTATCCTCAG No data
Right 1068391946 10:56409129-56409151 AGAGAGAAAGGGGAGCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068391940 Original CRISPR CTGAGGATAAGTAGCTCAAA TGG (reversed) Intergenic
No off target data available for this crispr