ID: 1068396284

View in Genome Browser
Species Human (GRCh38)
Location 10:56466080-56466102
Sequence CAGCAGGTGGAGACTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068396284_1068396291 9 Left 1068396284 10:56466080-56466102 CCATCCACAGTCTCCACCTGCTG No data
Right 1068396291 10:56466112-56466134 CACCCACAGCCTTTCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068396284 Original CRISPR CAGCAGGTGGAGACTGTGGA TGG (reversed) Intergenic
No off target data available for this crispr