ID: 1068398909

View in Genome Browser
Species Human (GRCh38)
Location 10:56503076-56503098
Sequence TAGATTATGCTGAACAGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068398906_1068398909 2 Left 1068398906 10:56503051-56503073 CCTGATTGCTCTGGCTAGGACTT 0: 500
1: 1485
2: 2479
3: 9378
4: 9649
Right 1068398909 10:56503076-56503098 TAGATTATGCTGAACAGGAGTGG No data
1068398903_1068398909 22 Left 1068398903 10:56503031-56503053 CCTTTTATTTCTTTCTCTTGCCT 0: 2791
1: 5828
2: 10697
3: 4557
4: 4309
Right 1068398909 10:56503076-56503098 TAGATTATGCTGAACAGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068398909 Original CRISPR TAGATTATGCTGAACAGGAG TGG Intergenic
No off target data available for this crispr