ID: 1068399419

View in Genome Browser
Species Human (GRCh38)
Location 10:56509055-56509077
Sequence ACTAGACAGTGCCCCAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068399419_1068399426 21 Left 1068399419 10:56509055-56509077 CCACCACTGGGGCACTGTCTAGT No data
Right 1068399426 10:56509099-56509121 CCATCCTCTAGACCCCAGAATGG 0: 56
1: 812
2: 1326
3: 1597
4: 1445
1068399419_1068399423 -5 Left 1068399419 10:56509055-56509077 CCACCACTGGGGCACTGTCTAGT No data
Right 1068399423 10:56509073-56509095 CTAGTGGAGCTGTGAGAAGAGGG 0: 1665
1: 2050
2: 1368
3: 825
4: 701
1068399419_1068399428 25 Left 1068399419 10:56509055-56509077 CCACCACTGGGGCACTGTCTAGT No data
Right 1068399428 10:56509103-56509125 CCTCTAGACCCCAGAATGGTAGG 0: 8
1: 37
2: 87
3: 64
4: 149
1068399419_1068399422 -6 Left 1068399419 10:56509055-56509077 CCACCACTGGGGCACTGTCTAGT No data
Right 1068399422 10:56509072-56509094 TCTAGTGGAGCTGTGAGAAGAGG 0: 103
1: 1764
2: 2044
3: 1393
4: 1006

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068399419 Original CRISPR ACTAGACAGTGCCCCAGTGG TGG (reversed) Intergenic
No off target data available for this crispr