ID: 1068401266

View in Genome Browser
Species Human (GRCh38)
Location 10:56530710-56530732
Sequence ATGACTTTCTTGAAGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068401260_1068401266 15 Left 1068401260 10:56530672-56530694 CCTAGCACTGAGTTTATTCATTG No data
Right 1068401266 10:56530710-56530732 ATGACTTTCTTGAAGACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068401266 Original CRISPR ATGACTTTCTTGAAGACTGA GGG Intergenic
No off target data available for this crispr