ID: 1068403014

View in Genome Browser
Species Human (GRCh38)
Location 10:56554623-56554645
Sequence AAGCAGTTACAAGTGGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068403014_1068403017 23 Left 1068403014 10:56554623-56554645 CCTTCAGCCACTTGTAACTGCTT No data
Right 1068403017 10:56554669-56554691 TTGGAGCTCTTTTATGTTATTGG No data
1068403014_1068403016 4 Left 1068403014 10:56554623-56554645 CCTTCAGCCACTTGTAACTGCTT No data
Right 1068403016 10:56554650-56554672 TTCAACTTTCATAGTGTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068403014 Original CRISPR AAGCAGTTACAAGTGGCTGA AGG (reversed) Intergenic
No off target data available for this crispr