ID: 1068410940

View in Genome Browser
Species Human (GRCh38)
Location 10:56653627-56653649
Sequence CTGTGGCAAGCCCAGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068410940_1068410946 -6 Left 1068410940 10:56653627-56653649 CCCCAACACTGGGCTTGCCACAG No data
Right 1068410946 10:56653644-56653666 CCACAGGAAAATTCAGCACTGGG No data
1068410940_1068410944 -7 Left 1068410940 10:56653627-56653649 CCCCAACACTGGGCTTGCCACAG No data
Right 1068410944 10:56653643-56653665 GCCACAGGAAAATTCAGCACTGG No data
1068410940_1068410949 20 Left 1068410940 10:56653627-56653649 CCCCAACACTGGGCTTGCCACAG No data
Right 1068410949 10:56653670-56653692 CCTCCACGGTCTCTACATCCAGG No data
1068410940_1068410947 6 Left 1068410940 10:56653627-56653649 CCCCAACACTGGGCTTGCCACAG No data
Right 1068410947 10:56653656-56653678 TCAGCACTGGGAAGCCTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068410940 Original CRISPR CTGTGGCAAGCCCAGTGTTG GGG (reversed) Intergenic
No off target data available for this crispr