ID: 1068410944

View in Genome Browser
Species Human (GRCh38)
Location 10:56653643-56653665
Sequence GCCACAGGAAAATTCAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068410943_1068410944 -9 Left 1068410943 10:56653629-56653651 CCAACACTGGGCTTGCCACAGGA No data
Right 1068410944 10:56653643-56653665 GCCACAGGAAAATTCAGCACTGG No data
1068410939_1068410944 0 Left 1068410939 10:56653620-56653642 CCTTGGGCCCCAACACTGGGCTT No data
Right 1068410944 10:56653643-56653665 GCCACAGGAAAATTCAGCACTGG No data
1068410941_1068410944 -8 Left 1068410941 10:56653628-56653650 CCCAACACTGGGCTTGCCACAGG No data
Right 1068410944 10:56653643-56653665 GCCACAGGAAAATTCAGCACTGG No data
1068410940_1068410944 -7 Left 1068410940 10:56653627-56653649 CCCCAACACTGGGCTTGCCACAG No data
Right 1068410944 10:56653643-56653665 GCCACAGGAAAATTCAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068410944 Original CRISPR GCCACAGGAAAATTCAGCAC TGG Intergenic
No off target data available for this crispr