ID: 1068410949

View in Genome Browser
Species Human (GRCh38)
Location 10:56653670-56653692
Sequence CCTCCACGGTCTCTACATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068410943_1068410949 18 Left 1068410943 10:56653629-56653651 CCAACACTGGGCTTGCCACAGGA No data
Right 1068410949 10:56653670-56653692 CCTCCACGGTCTCTACATCCAGG No data
1068410941_1068410949 19 Left 1068410941 10:56653628-56653650 CCCAACACTGGGCTTGCCACAGG No data
Right 1068410949 10:56653670-56653692 CCTCCACGGTCTCTACATCCAGG No data
1068410939_1068410949 27 Left 1068410939 10:56653620-56653642 CCTTGGGCCCCAACACTGGGCTT No data
Right 1068410949 10:56653670-56653692 CCTCCACGGTCTCTACATCCAGG No data
1068410940_1068410949 20 Left 1068410940 10:56653627-56653649 CCCCAACACTGGGCTTGCCACAG No data
Right 1068410949 10:56653670-56653692 CCTCCACGGTCTCTACATCCAGG No data
1068410945_1068410949 3 Left 1068410945 10:56653644-56653666 CCACAGGAAAATTCAGCACTGGG No data
Right 1068410949 10:56653670-56653692 CCTCCACGGTCTCTACATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068410949 Original CRISPR CCTCCACGGTCTCTACATCC AGG Intergenic
No off target data available for this crispr