ID: 1068410956

View in Genome Browser
Species Human (GRCh38)
Location 10:56653720-56653742
Sequence CACCCATTTGGTACTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068410956_1068410964 10 Left 1068410956 10:56653720-56653742 CCCACCCCAGTACCAAATGGGTG No data
Right 1068410964 10:56653753-56653775 GTGTAAGAAAGATTGCTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068410956 Original CRISPR CACCCATTTGGTACTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr