ID: 1068414383

View in Genome Browser
Species Human (GRCh38)
Location 10:56698583-56698605
Sequence TATTATGTATTGAAATTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068414380_1068414383 1 Left 1068414380 10:56698559-56698581 CCTTTGAAGATTTTATTGCCTGT No data
Right 1068414383 10:56698583-56698605 TATTATGTATTGAAATTAGGTGG No data
1068414378_1068414383 14 Left 1068414378 10:56698546-56698568 CCTTTAGAAACCACCTTTGAAGA No data
Right 1068414383 10:56698583-56698605 TATTATGTATTGAAATTAGGTGG No data
1068414379_1068414383 4 Left 1068414379 10:56698556-56698578 CCACCTTTGAAGATTTTATTGCC No data
Right 1068414383 10:56698583-56698605 TATTATGTATTGAAATTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068414383 Original CRISPR TATTATGTATTGAAATTAGG TGG Intergenic
No off target data available for this crispr