ID: 1068419892

View in Genome Browser
Species Human (GRCh38)
Location 10:56777925-56777947
Sequence CACAAAAACAGAAGAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068419890_1068419892 28 Left 1068419890 10:56777874-56777896 CCTGGTAGAAGCAGGATTTGATT No data
Right 1068419892 10:56777925-56777947 CACAAAAACAGAAGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068419892 Original CRISPR CACAAAAACAGAAGAGAAAG AGG Intergenic
No off target data available for this crispr