ID: 1068420935

View in Genome Browser
Species Human (GRCh38)
Location 10:56792175-56792197
Sequence CTGTTGTTTTAGAGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068420935_1068420940 30 Left 1068420935 10:56792175-56792197 CCATCTCCCCTCTAAAACAACAG No data
Right 1068420940 10:56792228-56792250 CGATAAACTTTTTAGTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068420935 Original CRISPR CTGTTGTTTTAGAGGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr