ID: 1068422702

View in Genome Browser
Species Human (GRCh38)
Location 10:56817305-56817327
Sequence GAGCAGCACGATGGCAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068422702_1068422706 4 Left 1068422702 10:56817305-56817327 CCTTCTTTGCCATCGTGCTGCTC No data
Right 1068422706 10:56817332-56817354 TAATTCCTGTCATCAAACAAGGG No data
1068422702_1068422705 3 Left 1068422702 10:56817305-56817327 CCTTCTTTGCCATCGTGCTGCTC No data
Right 1068422705 10:56817331-56817353 CTAATTCCTGTCATCAAACAAGG No data
1068422702_1068422708 27 Left 1068422702 10:56817305-56817327 CCTTCTTTGCCATCGTGCTGCTC No data
Right 1068422708 10:56817355-56817377 CAAATTTGTGAGAGTCTCTGTGG No data
1068422702_1068422709 28 Left 1068422702 10:56817305-56817327 CCTTCTTTGCCATCGTGCTGCTC No data
Right 1068422709 10:56817356-56817378 AAATTTGTGAGAGTCTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068422702 Original CRISPR GAGCAGCACGATGGCAAAGA AGG (reversed) Intergenic
No off target data available for this crispr