ID: 1068424958

View in Genome Browser
Species Human (GRCh38)
Location 10:56847854-56847876
Sequence AGAATATTGCCTTTGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068424958_1068424965 29 Left 1068424958 10:56847854-56847876 CCTTCCTTCAAAGGCAATATTCT No data
Right 1068424965 10:56847906-56847928 TCATACATGCCGAAGGATGCAGG No data
1068424958_1068424964 22 Left 1068424958 10:56847854-56847876 CCTTCCTTCAAAGGCAATATTCT No data
Right 1068424964 10:56847899-56847921 CCACTACTCATACATGCCGAAGG No data
1068424958_1068424960 -4 Left 1068424958 10:56847854-56847876 CCTTCCTTCAAAGGCAATATTCT No data
Right 1068424960 10:56847873-56847895 TTCTGTGAAGCCTTCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068424958 Original CRISPR AGAATATTGCCTTTGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr