ID: 1068438367

View in Genome Browser
Species Human (GRCh38)
Location 10:57019568-57019590
Sequence TTGTGGAAGGGGCAGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068438367_1068438376 2 Left 1068438367 10:57019568-57019590 CCCTCCCACTGCCCCTTCCACAA No data
Right 1068438376 10:57019593-57019615 AGAAATGTCAGGTGACGATCAGG No data
1068438367_1068438374 -9 Left 1068438367 10:57019568-57019590 CCCTCCCACTGCCCCTTCCACAA No data
Right 1068438374 10:57019582-57019604 CTTCCACAAACAGAAATGTCAGG No data
1068438367_1068438377 8 Left 1068438367 10:57019568-57019590 CCCTCCCACTGCCCCTTCCACAA No data
Right 1068438377 10:57019599-57019621 GTCAGGTGACGATCAGGTGATGG No data
1068438367_1068438378 16 Left 1068438367 10:57019568-57019590 CCCTCCCACTGCCCCTTCCACAA No data
Right 1068438378 10:57019607-57019629 ACGATCAGGTGATGGTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068438367 Original CRISPR TTGTGGAAGGGGCAGTGGGA GGG (reversed) Intergenic
No off target data available for this crispr