ID: 1068438721

View in Genome Browser
Species Human (GRCh38)
Location 10:57023018-57023040
Sequence GAGATTTAAAGGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068438716_1068438721 7 Left 1068438716 10:57022988-57023010 CCAGGCTTTCTTCTCAGATGGCC No data
Right 1068438721 10:57023018-57023040 GAGATTTAAAGGAAAGAGGAAGG No data
1068438712_1068438721 29 Left 1068438712 10:57022966-57022988 CCTGCATCAAAGAAGGCAGCACC No data
Right 1068438721 10:57023018-57023040 GAGATTTAAAGGAAAGAGGAAGG No data
1068438715_1068438721 8 Left 1068438715 10:57022987-57023009 CCCAGGCTTTCTTCTCAGATGGC No data
Right 1068438721 10:57023018-57023040 GAGATTTAAAGGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068438721 Original CRISPR GAGATTTAAAGGAAAGAGGA AGG Intergenic
No off target data available for this crispr