ID: 1068444190

View in Genome Browser
Species Human (GRCh38)
Location 10:57098959-57098981
Sequence ATGTATACAAATATGATTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068444187_1068444190 28 Left 1068444187 10:57098908-57098930 CCACTGCAATATAGATGTTCTTG No data
Right 1068444190 10:57098959-57098981 ATGTATACAAATATGATTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068444190 Original CRISPR ATGTATACAAATATGATTCA GGG Intergenic
No off target data available for this crispr