ID: 1068447821

View in Genome Browser
Species Human (GRCh38)
Location 10:57146178-57146200
Sequence AGGAAGAGCACAGTGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068447816_1068447821 27 Left 1068447816 10:57146128-57146150 CCATTTTCTGGCAGTGGCTGTTT No data
Right 1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068447821 Original CRISPR AGGAAGAGCACAGTGGTTGT GGG Intergenic
No off target data available for this crispr