ID: 1068462608

View in Genome Browser
Species Human (GRCh38)
Location 10:57347168-57347190
Sequence CCATTGCCACAAAAATACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068462608_1068462614 24 Left 1068462608 10:57347168-57347190 CCTAGGTATTTTTGTGGCAATGG No data
Right 1068462614 10:57347215-57347237 GGCTCTAGCTTGACTGTTGTTGG No data
1068462608_1068462612 3 Left 1068462608 10:57347168-57347190 CCTAGGTATTTTTGTGGCAATGG No data
Right 1068462612 10:57347194-57347216 ATGGGATTGCATTCCTGATTTGG 0: 101
1: 418
2: 857
3: 2210
4: 13527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068462608 Original CRISPR CCATTGCCACAAAAATACCT AGG (reversed) Intergenic
No off target data available for this crispr