ID: 1068469951

View in Genome Browser
Species Human (GRCh38)
Location 10:57448320-57448342
Sequence CTCCAGCTTGGTGAGGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068469951_1068469960 9 Left 1068469951 10:57448320-57448342 CCCCTCCCCTCACCAAGCTGGAG No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data
1068469951_1068469958 -10 Left 1068469951 10:57448320-57448342 CCCCTCCCCTCACCAAGCTGGAG No data
Right 1068469958 10:57448333-57448355 CAAGCTGGAGCGTCCTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068469951 Original CRISPR CTCCAGCTTGGTGAGGGGAG GGG (reversed) Intergenic