ID: 1068469953 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:57448322-57448344 |
| Sequence | CGCTCCAGCTTGGTGAGGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1068469953_1068469960 | 7 | Left | 1068469953 | 10:57448322-57448344 | CCTCCCCTCACCAAGCTGGAGCG | No data | ||
| Right | 1068469960 | 10:57448352-57448374 | TTGGCTTCCGACTGCTCTGCTGG | No data | ||||
| 1068469953_1068469962 | 30 | Left | 1068469953 | 10:57448322-57448344 | CCTCCCCTCACCAAGCTGGAGCG | No data | ||
| Right | 1068469962 | 10:57448375-57448397 | CAATGAGAATTTCAAGCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1068469953 | Original CRISPR | CGCTCCAGCTTGGTGAGGGG AGG (reversed) | Intergenic | ||