ID: 1068469953 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:57448322-57448344 |
Sequence | CGCTCCAGCTTGGTGAGGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1068469953_1068469960 | 7 | Left | 1068469953 | 10:57448322-57448344 | CCTCCCCTCACCAAGCTGGAGCG | No data | ||
Right | 1068469960 | 10:57448352-57448374 | TTGGCTTCCGACTGCTCTGCTGG | No data | ||||
1068469953_1068469962 | 30 | Left | 1068469953 | 10:57448322-57448344 | CCTCCCCTCACCAAGCTGGAGCG | No data | ||
Right | 1068469962 | 10:57448375-57448397 | CAATGAGAATTTCAAGCCAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1068469953 | Original CRISPR | CGCTCCAGCTTGGTGAGGGG AGG (reversed) | Intergenic | ||