ID: 1068469954

View in Genome Browser
Species Human (GRCh38)
Location 10:57448325-57448347
Sequence GGACGCTCCAGCTTGGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068469954_1068469960 4 Left 1068469954 10:57448325-57448347 CCCCTCACCAAGCTGGAGCGTCC No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data
1068469954_1068469962 27 Left 1068469954 10:57448325-57448347 CCCCTCACCAAGCTGGAGCGTCC No data
Right 1068469962 10:57448375-57448397 CAATGAGAATTTCAAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068469954 Original CRISPR GGACGCTCCAGCTTGGTGAG GGG (reversed) Intergenic