ID: 1068469955

View in Genome Browser
Species Human (GRCh38)
Location 10:57448326-57448348
Sequence AGGACGCTCCAGCTTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068469955_1068469962 26 Left 1068469955 10:57448326-57448348 CCCTCACCAAGCTGGAGCGTCCT No data
Right 1068469962 10:57448375-57448397 CAATGAGAATTTCAAGCCAGTGG 0: 11
1: 354
2: 558
3: 614
4: 528
1068469955_1068469960 3 Left 1068469955 10:57448326-57448348 CCCTCACCAAGCTGGAGCGTCCT No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068469955 Original CRISPR AGGACGCTCCAGCTTGGTGA GGG (reversed) Intergenic
No off target data available for this crispr