ID: 1068469960

View in Genome Browser
Species Human (GRCh38)
Location 10:57448352-57448374
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068469949_1068469960 27 Left 1068469949 10:57448302-57448324 CCTCAGTTATGGCAGACGCCCCT No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data
1068469951_1068469960 9 Left 1068469951 10:57448320-57448342 CCCCTCCCCTCACCAAGCTGGAG No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data
1068469956_1068469960 2 Left 1068469956 10:57448327-57448349 CCTCACCAAGCTGGAGCGTCCTA No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data
1068469955_1068469960 3 Left 1068469955 10:57448326-57448348 CCCTCACCAAGCTGGAGCGTCCT No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data
1068469954_1068469960 4 Left 1068469954 10:57448325-57448347 CCCCTCACCAAGCTGGAGCGTCC No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data
1068469957_1068469960 -3 Left 1068469957 10:57448332-57448354 CCAAGCTGGAGCGTCCTAGCTTG No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data
1068469952_1068469960 8 Left 1068469952 10:57448321-57448343 CCCTCCCCTCACCAAGCTGGAGC No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data
1068469953_1068469960 7 Left 1068469953 10:57448322-57448344 CCTCCCCTCACCAAGCTGGAGCG No data
Right 1068469960 10:57448352-57448374 TTGGCTTCCGACTGCTCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068469960 Original CRISPR TTGGCTTCCGACTGCTCTGC TGG Intergenic