ID: 1068479036

View in Genome Browser
Species Human (GRCh38)
Location 10:57565280-57565302
Sequence ATTCTGTCATTTGTGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068479036_1068479037 -9 Left 1068479036 10:57565280-57565302 CCATGTTTCACAAATGACAGAAT No data
Right 1068479037 10:57565294-57565316 TGACAGAATTTCATTTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068479036 Original CRISPR ATTCTGTCATTTGTGAAACA TGG (reversed) Intergenic
No off target data available for this crispr