ID: 1068480097

View in Genome Browser
Species Human (GRCh38)
Location 10:57579100-57579122
Sequence TGAGGAGGTCCCGAATAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068480090_1068480097 15 Left 1068480090 10:57579062-57579084 CCTTTATTTTCCTAAGGTGCTGT No data
Right 1068480097 10:57579100-57579122 TGAGGAGGTCCCGAATAAGGGGG No data
1068480091_1068480097 5 Left 1068480091 10:57579072-57579094 CCTAAGGTGCTGTTATGAGAAAG No data
Right 1068480097 10:57579100-57579122 TGAGGAGGTCCCGAATAAGGGGG No data
1068480089_1068480097 16 Left 1068480089 10:57579061-57579083 CCCTTTATTTTCCTAAGGTGCTG No data
Right 1068480097 10:57579100-57579122 TGAGGAGGTCCCGAATAAGGGGG No data
1068480087_1068480097 25 Left 1068480087 10:57579052-57579074 CCTAGGTCTCCCTTTATTTTCCT No data
Right 1068480097 10:57579100-57579122 TGAGGAGGTCCCGAATAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068480097 Original CRISPR TGAGGAGGTCCCGAATAAGG GGG Intergenic
No off target data available for this crispr