ID: 1068487742

View in Genome Browser
Species Human (GRCh38)
Location 10:57681240-57681262
Sequence GCTAGAGACTTACTTCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068487742_1068487750 20 Left 1068487742 10:57681240-57681262 CCTGTAAGAAGTAAGTCTCTAGC No data
Right 1068487750 10:57681283-57681305 CTTTATATTCATAAGGTGGCAGG No data
1068487742_1068487745 -7 Left 1068487742 10:57681240-57681262 CCTGTAAGAAGTAAGTCTCTAGC No data
Right 1068487745 10:57681256-57681278 CTCTAGCTAATGGCTTGGCCAGG No data
1068487742_1068487748 16 Left 1068487742 10:57681240-57681262 CCTGTAAGAAGTAAGTCTCTAGC No data
Right 1068487748 10:57681279-57681301 AGTCCTTTATATTCATAAGGTGG No data
1068487742_1068487747 13 Left 1068487742 10:57681240-57681262 CCTGTAAGAAGTAAGTCTCTAGC No data
Right 1068487747 10:57681276-57681298 AGGAGTCCTTTATATTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068487742 Original CRISPR GCTAGAGACTTACTTCTTAC AGG (reversed) Intergenic
No off target data available for this crispr