ID: 1068487750

View in Genome Browser
Species Human (GRCh38)
Location 10:57681283-57681305
Sequence CTTTATATTCATAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068487742_1068487750 20 Left 1068487742 10:57681240-57681262 CCTGTAAGAAGTAAGTCTCTAGC No data
Right 1068487750 10:57681283-57681305 CTTTATATTCATAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068487750 Original CRISPR CTTTATATTCATAAGGTGGC AGG Intergenic
No off target data available for this crispr