ID: 1068490238

View in Genome Browser
Species Human (GRCh38)
Location 10:57714023-57714045
Sequence CTTTGGAAGGCCAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068490230_1068490238 11 Left 1068490230 10:57713989-57714011 CCAGTCCTGGTGGCTCATGCTTG No data
Right 1068490238 10:57714023-57714045 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1068490231_1068490238 6 Left 1068490231 10:57713994-57714016 CCTGGTGGCTCATGCTTGTAATC 0: 46
1: 1071
2: 3183
3: 4436
4: 4755
Right 1068490238 10:57714023-57714045 CTTTGGAAGGCCAAGGTGGAAGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068490238 Original CRISPR CTTTGGAAGGCCAAGGTGGA AGG Intergenic
Too many off-targets to display for this crispr