ID: 1068491705

View in Genome Browser
Species Human (GRCh38)
Location 10:57732561-57732583
Sequence TAAGGCTCACATAATGCCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068491703_1068491705 -9 Left 1068491703 10:57732547-57732569 CCATTTCACTTTCTTAAGGCTCA No data
Right 1068491705 10:57732561-57732583 TAAGGCTCACATAATGCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068491705 Original CRISPR TAAGGCTCACATAATGCCGG TGG Intergenic
No off target data available for this crispr