ID: 1068502005

View in Genome Browser
Species Human (GRCh38)
Location 10:57851458-57851480
Sequence GAAATAAAACTGCTGGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068502005_1068502008 17 Left 1068502005 10:57851458-57851480 CCATGATCCAGCAGTTTTATTTC No data
Right 1068502008 10:57851498-57851520 AGAAATATAGCACCTTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068502005 Original CRISPR GAAATAAAACTGCTGGATCA TGG (reversed) Intergenic
No off target data available for this crispr