ID: 1068502006

View in Genome Browser
Species Human (GRCh38)
Location 10:57851465-57851487
Sequence GTTATCAGAAATAAAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068502006_1068502008 10 Left 1068502006 10:57851465-57851487 CCAGCAGTTTTATTTCTGATAAC No data
Right 1068502008 10:57851498-57851520 AGAAATATAGCACCTTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068502006 Original CRISPR GTTATCAGAAATAAAACTGC TGG (reversed) Intergenic