ID: 1068503318

View in Genome Browser
Species Human (GRCh38)
Location 10:57867642-57867664
Sequence TATTTTTAAACATGATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068503318_1068503320 18 Left 1068503318 10:57867642-57867664 CCAGAAAATCATGTTTAAAAATA No data
Right 1068503320 10:57867683-57867705 ATCTACAAGCTTTAGATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068503318 Original CRISPR TATTTTTAAACATGATTTTC TGG (reversed) Intergenic
No off target data available for this crispr