ID: 1068510784

View in Genome Browser
Species Human (GRCh38)
Location 10:57963391-57963413
Sequence CTTTGGAAGGGCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068510776_1068510784 -8 Left 1068510776 10:57963376-57963398 CCTGTAATCCCAGTGCTTTGGAA 0: 140
1: 2913
2: 25828
3: 327742
4: 267756
Right 1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068510784 Original CRISPR CTTTGGAAGGGCAAGGTGGG AGG Intergenic
No off target data available for this crispr