ID: 1068513786

View in Genome Browser
Species Human (GRCh38)
Location 10:58000639-58000661
Sequence GGCACCATGCGCATATATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068513786_1068513788 -1 Left 1068513786 10:58000639-58000661 CCAGAATATATGCGCATGGTGCC No data
Right 1068513788 10:58000661-58000683 CTCACACGTGCATAAGAAAGAGG No data
1068513786_1068513789 5 Left 1068513786 10:58000639-58000661 CCAGAATATATGCGCATGGTGCC No data
Right 1068513789 10:58000667-58000689 CGTGCATAAGAAAGAGGAAAAGG No data
1068513786_1068513790 8 Left 1068513786 10:58000639-58000661 CCAGAATATATGCGCATGGTGCC No data
Right 1068513790 10:58000670-58000692 GCATAAGAAAGAGGAAAAGGAGG No data
1068513786_1068513792 13 Left 1068513786 10:58000639-58000661 CCAGAATATATGCGCATGGTGCC No data
Right 1068513792 10:58000675-58000697 AGAAAGAGGAAAAGGAGGCAGGG No data
1068513786_1068513791 12 Left 1068513786 10:58000639-58000661 CCAGAATATATGCGCATGGTGCC No data
Right 1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068513786 Original CRISPR GGCACCATGCGCATATATTC TGG (reversed) Intergenic
No off target data available for this crispr