ID: 1068513791

View in Genome Browser
Species Human (GRCh38)
Location 10:58000674-58000696
Sequence AAGAAAGAGGAAAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068513786_1068513791 12 Left 1068513786 10:58000639-58000661 CCAGAATATATGCGCATGGTGCC No data
Right 1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG No data
1068513787_1068513791 -9 Left 1068513787 10:58000660-58000682 CCTCACACGTGCATAAGAAAGAG No data
Right 1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068513791 Original CRISPR AAGAAAGAGGAAAAGGAGGC AGG Intergenic
No off target data available for this crispr