ID: 1068516102

View in Genome Browser
Species Human (GRCh38)
Location 10:58027353-58027375
Sequence TGCCCTAGACCTAATGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068516100_1068516102 25 Left 1068516100 10:58027305-58027327 CCAGAAACTATCTGATTAACAGC No data
Right 1068516102 10:58027353-58027375 TGCCCTAGACCTAATGTTGATGG No data
1068516101_1068516102 -8 Left 1068516101 10:58027338-58027360 CCTCAAAAGTAAAGATGCCCTAG No data
Right 1068516102 10:58027353-58027375 TGCCCTAGACCTAATGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068516102 Original CRISPR TGCCCTAGACCTAATGTTGA TGG Intergenic